DNA Mutations Activity

google doc

Access the simulation at: https://learn.concord.org/eresources/1760.run_resource_html

Instructions on how the simulator works

Launch the Connected Bio Protein Synthesis simulation.

1.  Identify the parts of the model:

____  Ribosome
____  Amino Acids
____  tRNA
____  mRNA

label

3. Click on enter or edit DNA and copy this code:      
                   ATGCCAGGCGGCGAGAGCTAA

   Click the “Unfold Button” to see the protein sequence.   Click on each individual amino acid and write the sequence:

 

4. How many DNA triplets were in the original sequence?_____
 
    How many amino acids are in the final protein? _____

5.  Explain the significance of the last triplet (TAA) in the sequence:

 

6. Edit the DNA by changing  the 4th base to G
New sequence:  ATGGCAGGCGGCGAGAGCTAA
Check the new protein created by your new DNA.Write the new amino acid chain.

 

7. Return the triplet  to its original state (ATG). Now place an additional A after the G, your strand will read ATGA.   ATGACCAGGCGGCGAGAGCTAA   

  Check the new protein created by your new DNA.Write the new amino acid chain.

8. Return the triplet to its original state (ATG). Now change the second triplet from CCA to CCC.
    New sequence:  ATGCCCGGCGGCGAGAGCTAA

Check the new protein created by your new DNA. List the sequence of the new protein:

 Final Analysis -
There are three mutations you explored in this activity. You can use what you observed in the activity to help you answer the questions or search other sources if you are still confused.

9. First, you created a POINT mutation in your DNA. Describe what a point mutation is and how this can affect the protein created by the gene.

10. The second mutation you explored is called a FRAMESHIFT mutation. Explain what this means and how it affects the protein.

11. The third mutation you explored is a special kind of point mutation called a SILENT mutation. Explain what this means.

12.  Compare the different types of mutations.  Which type will have the greatest effect on the outcome of the protein?

google doc


Other Resources on DNA and Mutations

Genetics of Sickle Cell - simple version exploring how a change in a base of DNA can cause sickle cell disease

Drosophila and the Homeobox - explore genetic mutations in fruit flies that are associated with Hox genes

How DNA Controls the Workings of a Cell - examine a DNA sequence, transcribe and translate